Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 609224..609367 | Replicon | chromosome |
Accession | NZ_CP022148 | ||
Organism | Enterobacter roggenkampii strain 704SK10 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 609259..609362 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 609224..609367 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CES92_RS02940 | 605707..606369 | - | 663 | WP_008500463.1 | exodeoxyribonuclease X | - |
CES92_RS02945 | 606394..607044 | - | 651 | WP_063417217.1 | carbon-nitrogen hydrolase family protein | - |
CES92_RS02950 | 607155..607385 | - | 231 | WP_008500465.1 | DNA polymerase III subunit theta | - |
CES92_RS02955 | 607523..607894 | + | 372 | WP_008500466.1 | CopC domain-containing protein YobA | - |
CES92_RS02960 | 607896..608765 | + | 870 | WP_063417216.1 | copper homeostasis membrane protein CopD | - |
CES92_RS02965 | 608782..609120 | + | 339 | WP_008500468.1 | YebY family protein | - |
- | 609224..609367 | - | 144 | - | - | Antitoxin |
- | 609259..609362 | + | 104 | - | - | Toxin |
CES92_RS25305 | 609620..609865 | + | 246 | WP_165690317.1 | hypothetical protein | - |
CES92_RS02970 | 609906..610886 | + | 981 | WP_016947617.1 | IS5-like element ISKpn26 family transposase | - |
CES92_RS24940 | 610868..611899 | + | 1032 | WP_165769316.1 | hypothetical protein | - |
CES92_RS02985 | 611901..612323 | + | 423 | WP_063417214.1 | hypothetical protein | - |
CES92_RS02990 | 612323..613210 | + | 888 | WP_063417213.1 | hypothetical protein | - |
CES92_RS02995 | 613245..614312 | - | 1068 | WP_063417243.1 | phage integrase Arm DNA-binding domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 603650..680454 | 76804 | |
- | flank | IS/Tn | - | - | 609906..610886 | 980 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T78544 NZ_CP022148:609259-609362 [Enterobacter roggenkampii]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT78544 NZ_CP022148:c609367-609224 [Enterobacter roggenkampii]
CAAATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
CAAATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT