Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1132048..1132193 | Replicon | chromosome |
Accession | NZ_CP021757 | ||
Organism | Klebsiella pneumoniae strain AR_0138 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1132055..1132157 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1132048..1132193 (+) |
Genomic Context
Location: 1127579..1129012 (1434 bp)
Type: Others
Protein ID: WP_004148845.1
Type: Others
Protein ID: WP_004148845.1
Location: 1129128..1129367 (240 bp)
Type: Others
Protein ID: WP_002911393.1
Type: Others
Protein ID: WP_002911393.1
Location: 1129465..1129656 (192 bp)
Type: Others
Protein ID: WP_002911395.1
Type: Others
Protein ID: WP_002911395.1
Location: 1130463..1131431 (969 bp)
Type: Others
Protein ID: WP_014907334.1
Type: Others
Protein ID: WP_014907334.1
Location: 1131536..1131679 (144 bp)
Type: Others
Protein ID: WP_038431282.1
Type: Others
Protein ID: WP_038431282.1
Location: 1132048..1132193 (146 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 1134031..1134261 (231 bp)
Type: Others
Protein ID: WP_002911406.1
Type: Others
Protein ID: WP_002911406.1
Location: 1134340..1134999 (660 bp)
Type: Others
Protein ID: WP_002911407.1
Type: Others
Protein ID: WP_002911407.1
Location: 1129653..1130306 (654 bp)
Type: Others
Protein ID: WP_024622748.1
Type: Others
Protein ID: WP_024622748.1
Location: 1132055..1132157 (103 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 1132316..1132654 (339 bp)
Type: Others
Protein ID: WP_002911404.1
Type: Others
Protein ID: WP_002911404.1
Location: 1132671..1133540 (870 bp)
Type: Others
Protein ID: WP_004175431.1
Type: Others
Protein ID: WP_004175431.1
Location: 1133544..1133918 (375 bp)
Type: Others
Protein ID: WP_039819395.1
Type: Others
Protein ID: WP_039819395.1
Location: 1135003..1137063 (2061 bp)
Type: Others
Protein ID: WP_004151449.1
Type: Others
Protein ID: WP_004151449.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM385_RS05845 | 1127579..1129012 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
AM385_RS05850 | 1129128..1129367 | + | 240 | WP_002911393.1 | YebV family protein | - |
AM385_RS05855 | 1129465..1129656 | + | 192 | WP_002911395.1 | YebW family protein | - |
AM385_RS05860 | 1129653..1130306 | - | 654 | WP_024622748.1 | protein-serine/threonine phosphatase | - |
AM385_RS05865 | 1130463..1131431 | + | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
AM385_RS28890 | 1131536..1131679 | + | 144 | WP_038431282.1 | Ecr family regulatory small membrane protein | - |
- | 1132048..1132193 | + | 146 | - | - | Antitoxin |
- | 1132055..1132157 | - | 103 | - | - | Toxin |
AM385_RS05875 | 1132316..1132654 | - | 339 | WP_002911404.1 | YebY family protein | - |
AM385_RS05880 | 1132671..1133540 | - | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
AM385_RS05885 | 1133544..1133918 | - | 375 | WP_039819395.1 | CopC domain-containing protein YobA | - |
AM385_RS05890 | 1134031..1134261 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
AM385_RS05895 | 1134340..1134999 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
AM385_RS05900 | 1135003..1137063 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
No matching records found |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T77322 NZ_CP021757:c1132157-1132055 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT77322 NZ_CP021757:1132048-1132193 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT