Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2074598..2074743 | Replicon | chromosome |
Accession | NZ_CP021718 | ||
Organism | Klebsiella pneumoniae strain AR_0129 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2074605..2074707 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2074598..2074743 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM376_RS12970 | 2070479..2070718 | + | 240 | WP_002911393.1 | YebV family protein | - |
AM376_RS12975 | 2070816..2071007 | + | 192 | WP_002911395.1 | YebW family protein | - |
AM376_RS12980 | 2071004..2071657 | - | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
AM376_RS12985 | 2071814..2072782 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
AM376_RS30030 | 2072887..2073030 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
AM376_RS12990 | 2073190..2074170 | + | 981 | WP_000019473.1 | IS5-like element ISKpn26 family transposase | - |
- | 2074598..2074743 | + | 146 | - | - | Antitoxin |
- | 2074605..2074707 | - | 103 | - | - | Toxin |
AM376_RS13005 | 2074866..2075204 | - | 339 | WP_002911404.1 | YebY family protein | - |
AM376_RS13010 | 2075221..2076090 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
AM376_RS13015 | 2076094..2076468 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
AM376_RS13020 | 2076581..2076811 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
AM376_RS13025 | 2076890..2077549 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
AM376_RS13030 | 2077553..2079613 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 2073190..2074170 | 980 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T77106 NZ_CP021718:c2074707-2074605 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT77106 NZ_CP021718:2074598-2074743 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT