Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1922378..1922518 | Replicon | chromosome |
Accession | NZ_CP021164 | ||
Organism | Serratia marcescens strain 332 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1922422..1922518 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1922378..1922518 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
B1A42_RS09220 | 1917576..1918001 | + | 426 | WP_033653830.1 | RNA polymerase-binding protein DksA | - |
B1A42_RS09225 | 1918196..1919149 | + | 954 | WP_110158631.1 | prolyl aminopeptidase | - |
B1A42_RS09230 | 1919183..1919413 | - | 231 | WP_049272619.1 | DNA polymerase III subunit theta | - |
B1A42_RS09235 | 1919758..1920276 | + | 519 | WP_038875847.1 | non-heme ferritin | - |
B1A42_RS09240 | 1920569..1920985 | + | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
B1A42_RS09245 | 1920988..1921869 | + | 882 | WP_110157676.1 | copper homeostasis membrane protein CopD | - |
B1A42_RS09250 | 1921939..1922280 | + | 342 | WP_061872086.1 | YebY family protein | - |
- | 1922378..1922518 | - | 141 | - | - | Antitoxin |
- | 1922422..1922518 | + | 97 | - | - | Toxin |
B1A42_RS09255 | 1922570..1923091 | - | 522 | WP_110157677.1 | tyrosine-type recombinase/integrase | - |
B1A42_RS09260 | 1923005..1923451 | + | 447 | WP_162598272.1 | hypothetical protein | - |
B1A42_RS24600 | 1923802..1924416 | + | 615 | WP_162598273.1 | hypothetical protein | - |
B1A42_RS09270 | 1924704..1925774 | - | 1071 | WP_077791528.1 | AAA family ATPase | - |
B1A42_RS09275 | 1926069..1926296 | + | 228 | WP_110157680.1 | holin | - |
B1A42_RS09280 | 1926301..1926764 | + | 464 | Protein_1770 | lysozyme | - |
B1A42_RS09285 | 1926761..1927133 | + | 373 | Protein_1771 | DUF2570 family protein | - |
B1A42_RS24605 | 1927018..1927287 | + | 270 | WP_162531731.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1913696..1929282 | 15586 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T76078 NZ_CP021164:1922422-1922518 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT76078 NZ_CP021164:c1922518-1922378 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG