Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3625184..3625329 | Replicon | chromosome |
Accession | NZ_CP020853 | ||
Organism | Klebsiella pneumoniae strain KPN528 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3625191..3625293 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3625184..3625329 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
B8F96_RS17785 | 3620715..3622148 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
B8F96_RS17790 | 3622264..3622503 | + | 240 | WP_002911393.1 | YebV family protein | - |
B8F96_RS17795 | 3622601..3622792 | + | 192 | WP_002911395.1 | YebW family protein | - |
B8F96_RS17800 | 3622789..3623442 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
B8F96_RS17805 | 3623599..3624567 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
B8F96_RS30250 | 3624672..3624815 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3625184..3625329 | + | 146 | - | - | Antitoxin |
- | 3625191..3625293 | - | 103 | - | - | Toxin |
B8F96_RS17815 | 3625452..3625790 | - | 339 | WP_002911404.1 | YebY family protein | - |
B8F96_RS17820 | 3625807..3626676 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
B8F96_RS17825 | 3626680..3627054 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
B8F96_RS17830 | 3627167..3627397 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
B8F96_RS17835 | 3627476..3628135 | + | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
B8F96_RS17840 | 3628139..3630199 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 3606588..3698383 | 91795 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T75562 NZ_CP020853:c3625293-3625191 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT75562 NZ_CP020853:3625184-3625329 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT