Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 4352951..4353096 | Replicon | chromosome |
Accession | NZ_CP020067 | ||
Organism | Klebsiella pneumoniae strain AR_0068 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 4352987..4353089 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 4352951..4353096 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM447_RS21345 | 4348081..4350141 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
AM447_RS21350 | 4350145..4350804 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
AM447_RS21355 | 4350883..4351113 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
AM447_RS21360 | 4351226..4351600 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
AM447_RS21365 | 4351604..4352473 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
AM447_RS21370 | 4352490..4352828 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 4352951..4353096 | - | 146 | - | - | Antitoxin |
- | 4352987..4353089 | + | 103 | - | - | Toxin |
AM447_RS30895 | 4353465..4353608 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
AM447_RS21380 | 4353713..4354681 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
AM447_RS21385 | 4354838..4355491 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
AM447_RS21390 | 4355488..4355679 | - | 192 | WP_002911395.1 | YebW family protein | - |
AM447_RS21395 | 4355777..4356016 | - | 240 | WP_002911393.1 | YebV family protein | - |
AM447_RS21400 | 4356132..4357565 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 4279897..4370492 | 90595 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T73948 NZ_CP020067:4352987-4353089 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT73948 NZ_CP020067:c4353096-4352951 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT