Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1057794..1057895 | Replicon | chromosome |
Accession | NZ_CP020061 | ||
Organism | Klebsiella pneumoniae strain AR_0117 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1057794..1057888 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1057794..1057895 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM364_RS04985 | 1053606..1054265 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
AM364_RS04990 | 1054344..1054574 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
AM364_RS04995 | 1054687..1055061 | + | 375 | WP_020802218.1 | CopC domain-containing protein YobA | - |
AM364_RS05000 | 1055065..1055934 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
AM364_RS05005 | 1055951..1056289 | + | 339 | WP_016529031.1 | YebY family protein | - |
AM364_RS05010 | 1056477..1057685 | - | 1209 | WP_001339197.1 | IS4-like element ISVsa5 family transposase | - |
- | 1057794..1057888 | + | 95 | - | - | Toxin |
- | 1057794..1057895 | - | 102 | - | - | Antitoxin |
AM364_RS29270 | 1058263..1058406 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
AM364_RS05025 | 1058511..1059479 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
AM364_RS05030 | 1059636..1060289 | + | 654 | WP_020802220.1 | protein-serine/threonine phosphatase | - |
AM364_RS05035 | 1060286..1060477 | - | 192 | WP_002911395.1 | YebW family protein | - |
AM364_RS05040 | 1060575..1060814 | - | 240 | WP_002911393.1 | YebV family protein | - |
AM364_RS05045 | 1060930..1062363 | - | 1434 | WP_020802214.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 1056477..1057685 | 1208 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 95 bp
>T73921 NZ_CP020061:1057794-1057888 [Klebsiella pneumoniae]
ACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACAGGAATCGT
ATTCGGTCTCTTTTT
ACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACAGGAATCGT
ATTCGGTCTCTTTTT
Antitoxin
Download Length: 102 bp
>AT73921 NZ_CP020061:c1057895-1057794 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGT