Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 876197..876337 | Replicon | chromosome |
Accession | NZ_CP019986 | ||
Organism | Citrobacter werkmanii strain BF-6 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 876232..876335 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 876197..876337 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
B2G73_RS04265 | 872648..873310 | - | 663 | WP_042307829.1 | exodeoxyribonuclease X | - |
B2G73_RS04270 | 873333..873989 | - | 657 | WP_042307831.1 | carbon-nitrogen hydrolase family protein | - |
B2G73_RS04275 | 874096..874326 | - | 231 | WP_038641397.1 | DNA polymerase III subunit theta | - |
B2G73_RS04280 | 874470..874844 | + | 375 | WP_038641395.1 | CopC domain-containing protein YobA | - |
B2G73_RS04285 | 874848..875717 | + | 870 | WP_061381113.1 | copper homeostasis membrane protein CopD | - |
B2G73_RS04290 | 875738..876076 | + | 339 | WP_042307834.1 | YebY family protein | - |
- | 876197..876337 | - | 141 | - | - | Antitoxin |
- | 876232..876335 | + | 104 | - | - | Toxin |
B2G73_RS04295 | 876413..877462 | - | 1050 | WP_079226154.1 | tyrosine-type recombinase/integrase | - |
B2G73_RS04300 | 877359..877928 | + | 570 | WP_079223723.1 | DUF1367 family protein | - |
B2G73_RS04305 | 877928..878134 | + | 207 | WP_079223724.1 | hypothetical protein | - |
B2G73_RS04310 | 878137..878745 | + | 609 | WP_079223726.1 | recombination protein NinG | - |
B2G73_RS25595 | 878742..878879 | + | 138 | WP_016156248.1 | YlcG family protein | - |
B2G73_RS04315 | 878876..879556 | + | 681 | WP_079223728.1 | antiterminator | - |
B2G73_RS04320 | 879656..880108 | - | 453 | WP_079223729.1 | hypothetical protein | - |
B2G73_RS04325 | 880286..880564 | + | 279 | WP_079223735.1 | holin | - |
B2G73_RS04330 | 880536..881084 | + | 549 | WP_079223736.1 | lysozyme | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 856327..909340 | 53013 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T73652 NZ_CP019986:876232-876335 [Citrobacter werkmanii]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 141 bp
>AT73652 NZ_CP019986:c876337-876197 [Citrobacter werkmanii]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT