Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1889810..1889953 | Replicon | chromosome |
| Accession | NZ_CP019839 | ||
| Organism | Enterobacter roggenkampii strain R11 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1889845..1889948 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1889810..1889953 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| B1H21_RS09035 | 1886293..1886955 | - | 663 | WP_008500463.1 | exodeoxyribonuclease X | - |
| B1H21_RS09040 | 1886980..1887630 | - | 651 | WP_063417217.1 | carbon-nitrogen hydrolase family protein | - |
| B1H21_RS09045 | 1887741..1887971 | - | 231 | WP_008500465.1 | DNA polymerase III subunit theta | - |
| B1H21_RS09050 | 1888109..1888480 | + | 372 | WP_008500466.1 | CopC domain-containing protein YobA | - |
| B1H21_RS09055 | 1888482..1889351 | + | 870 | WP_063417216.1 | copper homeostasis membrane protein CopD | - |
| B1H21_RS09060 | 1889368..1889706 | + | 339 | WP_008500468.1 | YebY family protein | - |
| - | 1889810..1889953 | - | 144 | - | - | Antitoxin |
| - | 1889845..1889948 | + | 104 | - | - | Toxin |
| B1H21_RS24775 | 1890206..1890451 | + | 246 | WP_165690317.1 | hypothetical protein | - |
| B1H21_RS09065 | 1890492..1891472 | + | 981 | WP_000019445.1 | IS5-like element ISKpn26 family transposase | - |
| B1H21_RS09070 | 1891511..1892269 | - | 759 | WP_084833012.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| B1H21_RS09075 | 1892223..1892510 | - | 288 | WP_074166919.1 | excisionase | - |
| B1H21_RS09080 | 1892628..1892843 | - | 216 | WP_063417242.1 | hypothetical protein | - |
| B1H21_RS09085 | 1893189..1893470 | - | 282 | WP_084833013.1 | hypothetical protein | - |
| B1H21_RS24390 | 1893630..1893917 | - | 288 | WP_131828978.1 | hypothetical protein | - |
| B1H21_RS09095 | 1893914..1894741 | - | 828 | WP_084833015.1 | chromosome partitioning protein ParB | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 1883500..1959611 | 76111 | |
| - | flank | IS/Tn | - | - | 1890492..1891472 | 980 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T73322 NZ_CP019839:1889845-1889948 [Enterobacter roggenkampii]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT73322 NZ_CP019839:c1889953-1889810 [Enterobacter roggenkampii]
CAAATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
CAAATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
