Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1962814..1962959 | Replicon | chromosome |
Accession | NZ_CP019047 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain RJA166 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1962850..1962952 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1962814..1962959 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
RJA_RS09710 | 1957944..1960004 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
RJA_RS09715 | 1960008..1960667 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
RJA_RS09720 | 1960746..1960976 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
RJA_RS09725 | 1961089..1961463 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
RJA_RS09730 | 1961467..1962336 | + | 870 | WP_014907333.1 | copper homeostasis membrane protein CopD | - |
RJA_RS09735 | 1962353..1962691 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1962814..1962959 | - | 146 | - | - | Antitoxin |
- | 1962850..1962952 | + | 103 | - | - | Toxin |
RJA_RS29765 | 1963327..1963470 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
RJA_RS09745 | 1963575..1964543 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
RJA_RS09750 | 1964700..1965353 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
RJA_RS09755 | 1965350..1965541 | - | 192 | WP_002911395.1 | YebW family protein | - |
RJA_RS09760 | 1965639..1965878 | - | 240 | WP_002911393.1 | YebV family protein | - |
RJA_RS09765 | 1965994..1967427 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T71594 NZ_CP019047:1962850-1962952 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT71594 NZ_CP019047:c1962959-1962814 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT