Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1288547..1288687 | Replicon | chromosome |
Accession | NZ_CP018930 | ||
Organism | Serratia marcescens strain UMH12 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1288591..1288687 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1288547..1288687 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
BVG84_RS06235 | 1283817..1284212 | + | 396 | WP_049203470.1 | RidA family protein | - |
BVG84_RS06240 | 1284369..1285322 | + | 954 | WP_043141848.1 | prolyl aminopeptidase | - |
BVG84_RS06245 | 1285353..1285583 | - | 231 | WP_043141621.1 | DNA polymerase III subunit theta | - |
BVG84_RS06250 | 1285928..1286446 | + | 519 | WP_025302449.1 | non-heme ferritin | - |
BVG84_RS06255 | 1286771..1287154 | + | 384 | WP_043141618.1 | CopC domain-containing protein YobA | - |
BVG84_RS06260 | 1287157..1288038 | + | 882 | WP_060447371.1 | copper homeostasis membrane protein CopD | - |
BVG84_RS06265 | 1288108..1288449 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 1288547..1288687 | - | 141 | - | - | Antitoxin |
- | 1288591..1288687 | + | 97 | - | - | Toxin |
BVG84_RS06270 | 1288932..1289339 | + | 408 | WP_049204185.1 | hypothetical protein | - |
BVG84_RS06275 | 1289475..1289825 | + | 351 | WP_025302454.1 | DUF4377 domain-containing protein | - |
BVG84_RS06280 | 1289864..1290700 | - | 837 | WP_049209429.1 | aminoglycoside phosphotransferase family protein | - |
BVG84_RS06290 | 1290901..1292100 | + | 1200 | WP_025302456.1 | trans-2-enoyl-CoA reductase family protein | - |
BVG84_RS06295 | 1292258..1292821 | + | 564 | WP_025302458.1 | DUF2975 domain-containing protein | - |
BVG84_RS06300 | 1292796..1293044 | + | 249 | WP_165698098.1 | helix-turn-helix transcriptional regulator | - |
BVG84_RS06305 | 1293272..1293511 | + | 240 | WP_072008265.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T70939 NZ_CP018930:1288591-1288687 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT70939 NZ_CP018930:c1288687-1288547 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCATGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCATGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG