Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1295187..1295327 | Replicon | chromosome |
Accession | NZ_CP018928 | ||
Organism | Serratia marcescens strain UMH10 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1295231..1295327 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1295187..1295327 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
BVG92_RS06270 | 1290457..1290852 | + | 396 | WP_025302446.1 | RidA family protein | - |
BVG92_RS06275 | 1291009..1291962 | + | 954 | WP_025302447.1 | prolyl aminopeptidase | - |
BVG92_RS06280 | 1291993..1292223 | - | 231 | WP_043141621.1 | DNA polymerase III subunit theta | - |
BVG92_RS06285 | 1292568..1293086 | + | 519 | WP_025302449.1 | non-heme ferritin | - |
BVG92_RS06290 | 1293411..1293794 | + | 384 | WP_043141618.1 | CopC domain-containing protein YobA | - |
BVG92_RS06295 | 1293797..1294678 | + | 882 | WP_089180776.1 | copper homeostasis membrane protein CopD | - |
BVG92_RS06300 | 1294748..1295089 | + | 342 | WP_089180777.1 | YebY family protein | - |
- | 1295187..1295327 | - | 141 | - | - | Antitoxin |
- | 1295231..1295327 | + | 97 | - | - | Toxin |
BVG92_RS06305 | 1295572..1295979 | + | 408 | WP_049209427.1 | hypothetical protein | - |
BVG92_RS06310 | 1296115..1296465 | + | 351 | WP_025302454.1 | DUF4377 domain-containing protein | - |
BVG92_RS06315 | 1296504..1297340 | - | 837 | WP_049209429.1 | aminoglycoside phosphotransferase family protein | - |
BVG92_RS06325 | 1297541..1298740 | + | 1200 | WP_025302456.1 | trans-2-enoyl-CoA reductase family protein | - |
BVG92_RS06330 | 1298898..1299461 | + | 564 | WP_033642723.1 | DUF2975 domain-containing protein | - |
BVG92_RS06335 | 1299436..1299684 | + | 249 | WP_165698098.1 | helix-turn-helix transcriptional regulator | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T70901 NZ_CP018928:1295231-1295327 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT70901 NZ_CP018928:c1295327-1295187 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG