Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1305771..1305911 | Replicon | chromosome |
Accession | NZ_CP018923 | ||
Organism | Serratia marcescens strain UMH9 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1305815..1305911 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1305771..1305911 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
BVG96_RS06295 | 1300965..1301390 | + | 426 | WP_033638066.1 | RNA polymerase-binding protein DksA | - |
BVG96_RS06300 | 1301590..1302543 | + | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
BVG96_RS06305 | 1302575..1302805 | - | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
BVG96_RS06310 | 1303151..1303669 | + | 519 | WP_025302449.1 | non-heme ferritin | - |
BVG96_RS06315 | 1303995..1304378 | + | 384 | WP_060429883.1 | copper homeostasis periplasmic binding protein CopC | - |
BVG96_RS06320 | 1304381..1305262 | + | 882 | WP_060418439.1 | copper homeostasis membrane protein CopD | - |
BVG96_RS06325 | 1305332..1305673 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 1305771..1305911 | - | 141 | - | - | Antitoxin |
- | 1305815..1305911 | + | 97 | - | - | Toxin |
BVG96_RS06330 | 1306164..1306568 | + | 405 | WP_060418440.1 | hypothetical protein | - |
BVG96_RS06335 | 1306565..1306783 | - | 219 | WP_033638114.1 | hypothetical protein | - |
BVG96_RS06340 | 1306857..1307201 | - | 345 | WP_033638115.1 | hypothetical protein | - |
BVG96_RS06345 | 1307493..1307843 | + | 351 | WP_033638116.1 | DUF4377 domain-containing protein | - |
BVG96_RS06350 | 1308027..1309226 | + | 1200 | WP_060429885.1 | trans-2-enoyl-CoA reductase family protein | - |
BVG96_RS06355 | 1309454..1309672 | + | 219 | WP_033646423.1 | hypothetical protein | - |
BVG96_RS06360 | 1309844..1310149 | + | 306 | WP_033646422.1 | hypothetical protein | - |
BVG96_RS06365 | 1310193..1310528 | + | 336 | WP_033638120.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T70849 NZ_CP018923:1305815-1305911 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT70849 NZ_CP018923:c1305911-1305771 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG