Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 5166162..5166307 | Replicon | chromosome |
Accession | NZ_CP018306 | ||
Organism | Klebsiella pneumoniae strain Klebsiella pneumoniae 459 isolate 459 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 5166169..5166271 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 5166162..5166307 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
A9493_RS26100 | 5161693..5163126 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
A9493_RS26105 | 5163242..5163481 | + | 240 | WP_002911393.1 | YebV family protein | - |
A9493_RS26110 | 5163579..5163770 | + | 192 | WP_002911395.1 | YebW family protein | - |
A9493_RS26115 | 5163767..5164420 | - | 654 | WP_023280291.1 | protein-serine/threonine phosphatase | - |
A9493_RS26120 | 5164577..5165545 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
A9493_RS27140 | 5165650..5165793 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 5166162..5166307 | + | 146 | - | - | Antitoxin |
- | 5166169..5166271 | - | 103 | - | - | Toxin |
A9493_RS26130 | 5166430..5166768 | - | 339 | WP_002911404.1 | YebY family protein | - |
A9493_RS26135 | 5166785..5167654 | - | 870 | WP_100908237.1 | copper homeostasis membrane protein CopD | - |
A9493_RS26140 | 5167658..5168032 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
A9493_RS26145 | 5168145..5168375 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
A9493_RS26150 | 5168454..5169113 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
A9493_RS26155 | 5169117..5171177 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T69678 NZ_CP018306:c5166271-5166169 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT69678 NZ_CP018306:5166162-5166307 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT