Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 435321..435466 | Replicon | chromosome |
Accession | NZ_CP018056 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain H11 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 435357..435459 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 435321..435466 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KPH11_RS02010 | 430451..432511 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KPH11_RS02015 | 432515..433174 | - | 660 | WP_032425085.1 | exodeoxyribonuclease X | - |
KPH11_RS02020 | 433253..433483 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KPH11_RS02025 | 433596..433970 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KPH11_RS02030 | 433974..434843 | + | 870 | WP_099761193.1 | copper homeostasis membrane protein CopD | - |
KPH11_RS02035 | 434860..435198 | + | 339 | WP_016529031.1 | YebY family protein | - |
- | 435321..435466 | - | 146 | - | - | Antitoxin |
- | 435357..435459 | + | 103 | - | - | Toxin |
KPH11_RS26530 | 435835..435978 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KPH11_RS02045 | 436083..437051 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KPH11_RS02050 | 437208..437861 | + | 654 | WP_038807473.1 | protein-serine/threonine phosphatase | - |
KPH11_RS02055 | 437858..438049 | - | 192 | WP_002911395.1 | YebW family protein | - |
KPH11_RS02060 | 438147..438386 | - | 240 | WP_002911393.1 | YebV family protein | - |
KPH11_RS02065 | 438502..439935 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T68628 NZ_CP018056:435357-435459 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT68628 NZ_CP018056:c435466-435321 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT