Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1566009..1566154 | Replicon | chromosome |
Accession | NZ_CP015822 | ||
Organism | Klebsiella pneumoniae isolate blood sample |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1566016..1566118 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1566009..1566154 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
A8N26_RS08020 | 1561541..1562974 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
A8N26_RS08025 | 1563090..1563329 | + | 240 | WP_002911393.1 | YebV family protein | - |
A8N26_RS08030 | 1563427..1563618 | + | 192 | WP_002911395.1 | YebW family protein | - |
A8N26_RS08035 | 1563615..1564268 | - | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
A8N26_RS08040 | 1564425..1565393 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
A8N26_RS31595 | 1565498..1565641 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 1566009..1566154 | + | 146 | - | - | Antitoxin |
- | 1566016..1566118 | - | 103 | - | - | Toxin |
A8N26_RS08050 | 1566277..1566615 | - | 339 | WP_002911404.1 | YebY family protein | - |
A8N26_RS08055 | 1566632..1567501 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
A8N26_RS08060 | 1567505..1567879 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
A8N26_RS08065 | 1567992..1568222 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
A8N26_RS08070 | 1568301..1568960 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
A8N26_RS08075 | 1568964..1571024 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T63499 NZ_CP015822:c1566118-1566016 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT63499 NZ_CP015822:1566009-1566154 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT