Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3457551..3457696 | Replicon | chromosome |
Accession | NZ_CP014762 | ||
Organism | Klebsiella pneumoniae strain KPNIH39 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3457558..3457660 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3457551..3457696 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
WM47_RS17380 | 3453432..3453671 | + | 240 | WP_002911393.1 | YebV family protein | - |
WM47_RS17385 | 3453769..3453960 | + | 192 | WP_002911395.1 | YebW family protein | - |
WM47_RS17390 | 3453957..3454610 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
WM47_RS17395 | 3454767..3455735 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
WM47_RS31305 | 3455840..3455983 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
WM47_RS17405 | 3456183..3457163 | + | 981 | WP_009310076.1 | IS5-like element ISKpn26 family transposase | - |
- | 3457551..3457696 | + | 146 | - | - | Antitoxin |
- | 3457558..3457660 | - | 103 | - | - | Toxin |
WM47_RS17410 | 3457819..3458157 | - | 339 | WP_002911404.1 | YebY family protein | - |
WM47_RS17415 | 3458174..3459043 | - | 870 | WP_004189267.1 | copper homeostasis membrane protein CopD | - |
WM47_RS17420 | 3459047..3459421 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
WM47_RS17425 | 3459534..3459764 | + | 231 | WP_064798405.1 | DNA polymerase III subunit theta | - |
WM47_RS17430 | 3459843..3460502 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
WM47_RS17435 | 3460506..3462566 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 3456183..3457163 | 980 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T61776 NZ_CP014762:c3457660-3457558 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT61776 NZ_CP014762:3457551-3457696 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT