Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1833613..1833760 | Replicon | chromosome |
Accession | NZ_CP014696 | ||
Organism | Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1833617..1833719 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1833613..1833760 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AVR78_RS09480 | 1829129..1830562 | + | 1434 | WP_004203381.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
AVR78_RS09485 | 1830679..1830918 | + | 240 | WP_002911393.1 | YebV family protein | - |
AVR78_RS09490 | 1831016..1831207 | + | 192 | WP_002911395.1 | YebW family protein | - |
AVR78_RS09495 | 1831204..1831857 | - | 654 | WP_004203382.1 | protein-serine/threonine phosphatase | - |
AVR78_RS09500 | 1832014..1832982 | + | 969 | WP_004203383.1 | VirK/YbjX family protein | - |
AVR78_RS28970 | 1833086..1833229 | + | 144 | WP_032425946.1 | Ecr family regulatory small membrane protein | - |
- | 1833613..1833760 | + | 148 | - | - | Antitoxin |
- | 1833617..1833719 | - | 103 | - | - | Toxin |
AVR78_RS09515 | 1833878..1834216 | - | 339 | WP_002911404.1 | YebY family protein | - |
AVR78_RS09520 | 1834233..1835102 | - | 870 | WP_004203385.1 | copper homeostasis membrane protein CopD | - |
AVR78_RS09525 | 1835106..1835480 | - | 375 | WP_004203386.1 | CopC domain-containing protein YobA | - |
AVR78_RS09530 | 1835593..1835823 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
AVR78_RS09535 | 1835902..1836561 | + | 660 | WP_004203387.1 | exodeoxyribonuclease X | - |
AVR78_RS09545 | 1836565..1838625 | - | 2061 | WP_004203388.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T61698 NZ_CP014696:c1833719-1833617 [Klebsiella quasipneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 148 bp
>AT61698 NZ_CP014696:1833613-1833760 [Klebsiella quasipneumoniae]
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG