Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3290212..3290357 | Replicon | chromosome |
Accession | NZ_CP014008 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain RJF293 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3290219..3290321 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3290212..3290357 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
RJF2_RS16145 | 3285744..3287177 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
RJF2_RS16150 | 3287293..3287532 | + | 240 | WP_002911393.1 | YebV family protein | - |
RJF2_RS16155 | 3287630..3287821 | + | 192 | WP_002911395.1 | YebW family protein | - |
RJF2_RS16160 | 3287818..3288471 | - | 654 | WP_032446225.1 | protein-serine/threonine phosphatase | - |
RJF2_RS16165 | 3288628..3289596 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
RJF2_RS28655 | 3289701..3289844 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3290212..3290357 | + | 146 | - | - | Antitoxin |
- | 3290219..3290321 | - | 103 | - | - | Toxin |
RJF2_RS16175 | 3290480..3290818 | - | 339 | WP_002911404.1 | YebY family protein | - |
RJF2_RS16180 | 3290835..3291704 | - | 870 | WP_060175960.1 | copper homeostasis membrane protein CopD | - |
RJF2_RS16185 | 3291708..3292082 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
RJF2_RS16190 | 3292195..3292425 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
RJF2_RS16195 | 3292504..3293163 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
RJF2_RS16200 | 3293167..3295227 | - | 2061 | WP_004148850.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T59853 NZ_CP014008:c3290321-3290219 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT59853 NZ_CP014008:3290212-3290357 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT