Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 712655..712800 | Replicon | chromosome |
Accession | NZ_CP012883 | ||
Organism | Klebsiella pneumoniae KP-1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 712662..712764 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 712655..712800 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KLP1_RS03585 | 708186..709619 | + | 1434 | WP_021440382.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
KLP1_RS03590 | 709735..709974 | + | 240 | WP_002911393.1 | YebV family protein | - |
KLP1_RS03595 | 710072..710263 | + | 192 | WP_002911395.1 | YebW family protein | - |
KLP1_RS03600 | 710260..710913 | - | 654 | WP_021440384.1 | protein-serine/threonine phosphatase | - |
KLP1_RS03605 | 711070..712038 | + | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
KLP1_RS28585 | 712143..712286 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 712655..712800 | + | 146 | - | - | Antitoxin |
- | 712662..712764 | - | 103 | - | - | Toxin |
KLP1_RS03615 | 712923..713261 | - | 339 | WP_002911404.1 | YebY family protein | - |
KLP1_RS03620 | 713278..714147 | - | 870 | WP_021440385.1 | copper homeostasis membrane protein CopD | - |
KLP1_RS03625 | 714151..714525 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KLP1_RS03630 | 714638..714868 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KLP1_RS03635 | 714947..715606 | + | 660 | WP_021440386.1 | exodeoxyribonuclease X | - |
KLP1_RS03640 | 715610..717670 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T57407 NZ_CP012883:c712764-712662 [Klebsiella pneumoniae KP-1]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT57407 NZ_CP012883:712655-712800 [Klebsiella pneumoniae KP-1]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT