Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 262398..262543 | Replicon | chromosome |
Accession | NZ_CP012753 | ||
Organism | Klebsiella pneumoniae strain KP617 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 262434..262536 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 262398..262543 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AN966_RS01270 | 257528..259588 | + | 2061 | WP_060722665.1 | oligopeptidase B | - |
AN966_RS01275 | 259592..260251 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
AN966_RS01280 | 260330..260560 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
AN966_RS01285 | 260673..261047 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
AN966_RS01290 | 261051..261920 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
AN966_RS01295 | 261937..262275 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 262398..262543 | - | 146 | - | - | Antitoxin |
- | 262434..262536 | + | 103 | - | - | Toxin |
AN966_RS29940 | 262912..263055 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
AN966_RS01305 | 263160..264128 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
AN966_RS01310 | 264285..264938 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
AN966_RS01315 | 264935..265126 | - | 192 | WP_002911395.1 | YebW family protein | - |
AN966_RS01320 | 265224..265463 | - | 240 | WP_002911393.1 | YebV family protein | - |
AN966_RS01325 | 265579..267012 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 189344..279939 | 90595 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T57176 NZ_CP012753:262434-262536 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT57176 NZ_CP012753:c262543-262398 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT