Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2173996..2174141 | Replicon | chromosome |
Accession | NZ_CP012745 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain TGH13 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2174032..2174134 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2173996..2174141 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AOG30_RS10670 | 2169126..2171186 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
AOG30_RS10675 | 2171190..2171849 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
AOG30_RS10680 | 2171928..2172158 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
AOG30_RS10685 | 2172271..2172645 | + | 375 | WP_060577972.1 | CopC domain-containing protein YobA | - |
AOG30_RS10690 | 2172649..2173518 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
AOG30_RS10695 | 2173535..2173873 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2173996..2174141 | - | 146 | - | - | Antitoxin |
- | 2174032..2174134 | + | 103 | - | - | Toxin |
AOG30_RS28110 | 2174510..2174653 | - | 144 | WP_038431282.1 | Ecr family regulatory small membrane protein | - |
AOG30_RS10705 | 2174758..2175726 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
AOG30_RS10710 | 2175883..2176536 | + | 654 | WP_024622748.1 | protein-serine/threonine phosphatase | - |
AOG30_RS10715 | 2176533..2176724 | - | 192 | WP_002911395.1 | YebW family protein | - |
AOG30_RS10720 | 2176822..2177061 | - | 240 | WP_002911393.1 | YebV family protein | - |
AOG30_RS10725 | 2177177..2178610 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T57155 NZ_CP012745:2174032-2174134 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT57155 NZ_CP012745:c2174141-2173996 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT