Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2030441..2030586 | Replicon | chromosome |
Accession | NZ_CP012743 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain TGH8 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2030477..2030579 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2030441..2030586 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AOD72_RS10070 | 2025571..2027631 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
AOD72_RS10075 | 2027635..2028294 | - | 660 | WP_032425085.1 | exodeoxyribonuclease X | - |
AOD72_RS10080 | 2028373..2028603 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
AOD72_RS10085 | 2028716..2029090 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
AOD72_RS10090 | 2029094..2029963 | + | 870 | WP_004189267.1 | copper homeostasis membrane protein CopD | - |
AOD72_RS10095 | 2029980..2030318 | + | 339 | WP_016529031.1 | YebY family protein | - |
- | 2030441..2030586 | - | 146 | - | - | Antitoxin |
- | 2030477..2030579 | + | 103 | - | - | Toxin |
AOD72_RS29450 | 2030954..2031097 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
AOD72_RS10105 | 2031202..2032170 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
AOD72_RS10110 | 2032327..2032980 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
AOD72_RS10115 | 2032977..2033168 | - | 192 | WP_002911395.1 | YebW family protein | - |
AOD72_RS10120 | 2033266..2033505 | - | 240 | WP_002911393.1 | YebV family protein | - |
AOD72_RS10125 | 2033621..2035054 | - | 1434 | WP_032411854.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T57120 NZ_CP012743:2030477-2030579 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT57120 NZ_CP012743:c2030586-2030441 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT