Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1913344..1913489 | Replicon | chromosome |
Accession | NZ_CP011985 | ||
Organism | Klebsiella pneumoniae UHKPC07 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1913380..1913482 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1913344..1913489 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
H224_RS09495 | 1908474..1910534 | + | 2061 | WP_032422099.1 | oligopeptidase B | - |
H224_RS09500 | 1910538..1911197 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
H224_RS09505 | 1911276..1911506 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
H224_RS09510 | 1911619..1911993 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
H224_RS09515 | 1911997..1912866 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
H224_RS09520 | 1912883..1913221 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1913344..1913489 | - | 146 | - | - | Antitoxin |
- | 1913380..1913482 | + | 103 | - | - | Toxin |
H224_RS29810 | 1913857..1914000 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
H224_RS09530 | 1914105..1915073 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
H224_RS09535 | 1915230..1915883 | + | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
H224_RS09540 | 1915880..1916071 | - | 192 | WP_002911395.1 | YebW family protein | - |
H224_RS09545 | 1916169..1916408 | - | 240 | WP_002911393.1 | YebV family protein | - |
H224_RS09550 | 1916524..1917957 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T55369 NZ_CP011985:1913380-1913482 [Klebsiella pneumoniae UHKPC07]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT55369 NZ_CP011985:c1913489-1913344 [Klebsiella pneumoniae UHKPC07]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT