Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1964123..1964268 | Replicon | chromosome |
Accession | NZ_CP011976 | ||
Organism | Klebsiella pneumoniae DMC1097 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1964159..1964261 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1964123..1964268 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
H218_RS09835 | 1959253..1961313 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
H218_RS09840 | 1961317..1961976 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
H218_RS09845 | 1962055..1962285 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
H218_RS09850 | 1962398..1962772 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
H218_RS09855 | 1962776..1963645 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
H218_RS09860 | 1963662..1964000 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1964123..1964268 | - | 146 | - | - | Antitoxin |
- | 1964159..1964261 | + | 103 | - | - | Toxin |
H218_RS30935 | 1964636..1964779 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
H218_RS09870 | 1964884..1965852 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
H218_RS09875 | 1966009..1966662 | + | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
H218_RS09880 | 1966659..1966850 | - | 192 | WP_002911395.1 | YebW family protein | - |
H218_RS09885 | 1966948..1967187 | - | 240 | WP_002911393.1 | YebV family protein | - |
H218_RS09890 | 1967303..1968736 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T55327 NZ_CP011976:1964159-1964261 [Klebsiella pneumoniae DMC1097]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT55327 NZ_CP011976:c1964268-1964123 [Klebsiella pneumoniae DMC1097]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT