Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 23973..24066 | Replicon | chromosome |
Accession | NZ_CP011975 | ||
Organism | Yersinia aleksiciae strain 159 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 23974..24066 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 23973..24066 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
ACZ76_RS00150 | 18987..19319 | + | 333 | WP_048615680.1 | hypothetical protein | - |
ACZ76_RS00155 | 19508..19822 | + | 315 | WP_048615682.1 | hypothetical protein | - |
ACZ76_RS00160 | 19836..21989 | + | 2154 | WP_048615684.1 | hypothetical protein | - |
ACZ76_RS00165 | 21986..22498 | + | 513 | WP_025378520.1 | siphovirus Gp157 family protein | - |
ACZ76_RS00170 | 22571..22837 | + | 267 | WP_025378521.1 | excisionase | - |
ACZ76_RS00175 | 22812..23894 | + | 1083 | WP_048615686.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 23973..24066 | + | 94 | - | - | Antitoxin |
- | 23974..24066 | - | 93 | - | - | Toxin |
ACZ76_RS00180 | 24240..24581 | - | 342 | WP_048615688.1 | YebY family protein | - |
ACZ76_RS00185 | 24678..25562 | - | 885 | WP_048615690.1 | copper homeostasis membrane protein CopD | - |
ACZ76_RS00190 | 25564..25950 | - | 387 | WP_032814982.1 | CopC domain-containing protein YobA | - |
ACZ76_RS00195 | 26345..26854 | - | 510 | WP_048615694.1 | non-heme ferritin | - |
ACZ76_RS00200 | 27245..27475 | + | 231 | WP_048615696.1 | DNA polymerase III subunit theta | - |
ACZ76_RS00205 | 27529..28485 | - | 957 | WP_048615698.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 347..29666 | 29319 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 93 bp
>T55311 NZ_CP011975:c24066-23974 [Yersinia aleksiciae]
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTCTTTTT
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTCTTTTT
Antitoxin
Download Length: 94 bp
>AT55311 NZ_CP011975:23973-24066 [Yersinia aleksiciae]
TAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAACGTAGGCTTA
TAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAACGTAGGCTTA