Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 5255767..5255869 | Replicon | chromosome |
Accession | NZ_CP011254 | ||
Organism | Serratia fonticola strain DSM 4576 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 5255774..5255869 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 5255767..5255860 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
WN53_RS23275 | 5251325..5252014 | - | 690 | WP_024485872.1 | DUF4145 domain-containing protein | - |
WN53_RS23280 | 5252262..5252645 | - | 384 | WP_024485871.1 | DUF2570 family protein | - |
WN53_RS23285 | 5252642..5253268 | - | 627 | WP_024485870.1 | glycoside hydrolase family 19 protein | - |
WN53_RS26950 | 5253273..5253683 | - | 411 | WP_052754330.1 | phage holin family protein | - |
WN53_RS28285 | 5253831..5254274 | + | 444 | WP_024485868.1 | hypothetical protein | - |
WN53_RS23300 | 5254570..5255238 | - | 669 | WP_024485867.1 | hypothetical protein | - |
WN53_RS27750 | 5255556..5255723 | - | 168 | WP_167669108.1 | DUF1133 family protein | - |
- | 5255767..5255860 | + | 94 | - | - | Antitoxin |
- | 5255774..5255869 | - | 96 | - | - | Toxin |
WN53_RS23305 | 5256010..5256351 | - | 342 | WP_021806756.1 | YebY family protein | - |
WN53_RS23310 | 5256421..5257302 | - | 882 | WP_024485866.1 | copper homeostasis membrane protein CopD | - |
WN53_RS23315 | 5257306..5257689 | - | 384 | WP_024485865.1 | CopC domain-containing protein YobA | - |
WN53_RS23320 | 5258130..5258648 | - | 519 | WP_024485864.1 | non-heme ferritin | - |
WN53_RS23325 | 5259038..5259268 | + | 231 | WP_024485863.1 | DNA polymerase III subunit theta | - |
WN53_RS23330 | 5259404..5260393 | - | 990 | WP_046808321.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 5228387..5269140 | 40753 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 96 bp
>T53726 NZ_CP011254:c5255869-5255774 [Serratia fonticola]
AACAAACCTTGCATAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCCTTTCCCTAGACCGAGTATAGGAATCG
TACTCGGTCTTTTTTT
AACAAACCTTGCATAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCCTTTCCCTAGACCGAGTATAGGAATCG
TACTCGGTCTTTTTTT
Antitoxin
Download Length: 94 bp
>AT53726 NZ_CP011254:5255767-5255860 [Serratia fonticola]
AAAAGATAAAAAAAGACCGAGTACGATTCCTATACTCGGTCTAGGGAAAGGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTTATGCA
AAAAGATAAAAAAAGACCGAGTACGATTCCTATACTCGGTCTAGGGAAAGGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTTATGCA