Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2032408..2032532 | Replicon | chromosome |
Accession | NZ_CP011118 | ||
Organism | Yersinia enterocolitica strain FORC_002 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2032430..2032524 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2032408..2032532 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
FORC2_RS09145 | 2028024..2028980 | + | 957 | WP_019079708.1 | prolyl aminopeptidase | - |
FORC2_RS09150 | 2029029..2029262 | - | 234 | WP_046694906.1 | DNA polymerase III subunit theta | - |
FORC2_RS09155 | 2029646..2030155 | + | 510 | WP_005170444.1 | non-heme ferritin | - |
FORC2_RS09160 | 2030546..2030932 | + | 387 | WP_005170441.1 | CopC domain-containing protein YobA | - |
FORC2_RS09165 | 2030934..2031818 | + | 885 | WP_046694907.1 | copper homeostasis membrane protein CopD | - |
FORC2_RS09170 | 2031915..2032256 | + | 342 | WP_005170437.1 | YebY family protein | - |
- | 2032408..2032532 | - | 125 | - | - | Antitoxin |
- | 2032430..2032524 | + | 95 | - | - | Toxin |
FORC2_RS09175 | 2032603..2033202 | - | 600 | Protein_1810 | tyrosine-type recombinase/integrase | - |
FORC2_RS09180 | 2033199..2033669 | + | 471 | Protein_1811 | hypothetical protein | - |
FORC2_RS09185 | 2033676..2034080 | + | 405 | WP_019079703.1 | hypothetical protein | - |
FORC2_RS09190 | 2034083..2034472 | + | 390 | WP_019079702.1 | hypothetical protein | - |
FORC2_RS09195 | 2034735..2035313 | + | 579 | WP_046694908.1 | hypothetical protein | - |
FORC2_RS09200 | 2035303..2035599 | + | 297 | WP_102895904.1 | hypothetical protein | - |
FORC2_RS09205 | 2035717..2037381 | + | 1665 | WP_046694910.1 | glycoside hydrolase family 104 protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2026851..2066982 | 40131 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 95 bp
>T53459 NZ_CP011118:2032430-2032524 [Yersinia enterocolitica]
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTCTTTTT
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTCTTTTT
Antitoxin
Download Length: 125 bp
>AT53459 NZ_CP011118:c2032532-2032408 [Yersinia enterocolitica]
AACAGCTTAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG
AACAGCTTAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG