Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1972626..1972770 | Replicon | chromosome |
Accession | NZ_CP010523 | ||
Organism | Klebsiella variicola strain DSM 15968 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1972662..1972764 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1972626..1972770 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SP68_RS09225 | 1967756..1969816 | + | 2061 | WP_012541258.1 | oligopeptidase B | - |
SP68_RS09230 | 1969820..1970479 | - | 660 | WP_022066251.1 | exodeoxyribonuclease X | - |
SP68_RS09235 | 1970558..1970788 | - | 231 | WP_012541260.1 | DNA polymerase III subunit theta | - |
SP68_RS09240 | 1970902..1971276 | + | 375 | WP_008804269.1 | CopC domain-containing protein YobA | - |
SP68_RS09245 | 1971280..1972149 | + | 870 | WP_012541262.1 | copper homeostasis membrane protein CopD | - |
SP68_RS09250 | 1972166..1972504 | + | 339 | WP_008804271.1 | YebY family protein | - |
- | 1972626..1972770 | - | 145 | - | - | Antitoxin |
- | 1972662..1972764 | + | 103 | - | - | Toxin |
SP68_RS27785 | 1973149..1973292 | - | 144 | WP_046621074.1 | Ecr family regulatory small membrane protein | - |
SP68_RS09255 | 1973396..1974385 | - | 990 | WP_032691211.1 | VirK/YbjX family protein | - |
SP68_RS09260 | 1974521..1975174 | + | 654 | WP_022066249.1 | protein-serine/threonine phosphatase | - |
SP68_RS09265 | 1975171..1975362 | - | 192 | WP_002911395.1 | YebW family protein | - |
SP68_RS09270 | 1975460..1975699 | - | 240 | WP_002911393.1 | YebV family protein | - |
SP68_RS09275 | 1975815..1977248 | - | 1434 | WP_012967754.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T52750 NZ_CP010523:1972662-1972764 [Klebsiella variicola]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 145 bp
>AT52750 NZ_CP010523:c1972770-1972626 [Klebsiella variicola]
ACCGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ACCGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT