Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 192298..192422 | Replicon | chromosome |
Accession | NZ_CP009997 | ||
Organism | Yersinia kristensenii strain Y231 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 192322..192414 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 192298..192422 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CH54_RS00835 | 187906..188862 | + | 957 | WP_038632429.1 | prolyl aminopeptidase | - |
CH54_RS00840 | 188912..189145 | - | 234 | WP_038632437.1 | DNA polymerase III subunit theta | - |
CH54_RS00845 | 189539..190048 | + | 510 | WP_038632439.1 | non-heme ferritin | - |
CH54_RS00850 | 190438..190824 | + | 387 | WP_038632441.1 | CopC domain-containing protein YobA | - |
CH54_RS00855 | 190826..191710 | + | 885 | WP_038632443.1 | copper homeostasis membrane protein CopD | - |
CH54_RS00860 | 191807..192148 | + | 342 | WP_038632445.1 | YebY family protein | - |
- | 192298..192422 | - | 125 | - | - | Antitoxin |
- | 192322..192414 | + | 93 | - | - | Toxin |
CH54_RS00865 | 192674..193301 | + | 628 | Protein_175 | terminase small subunit | - |
CH54_RS00870 | 193312..193596 | - | 285 | WP_038632447.1 | type II toxin-antitoxin system RelE/ParE family toxin | - |
CH54_RS00875 | 193586..193825 | - | 240 | WP_012105237.1 | type II toxin-antitoxin system RelB/DinJ family antitoxin | - |
CH54_RS21155 | 193952..194122 | + | 171 | WP_187142909.1 | hypothetical protein | - |
CH54_RS00880 | 194405..195568 | - | 1164 | WP_071841717.1 | class C beta-lactamase | - |
CH54_RS00885 | 195837..196709 | + | 873 | WP_038632453.1 | 23S rRNA pseudouridine(2604) synthase RluF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 186728..199205 | 12477 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 93 bp
>T50225 NZ_CP009997:192322-192414 [Yersinia kristensenii]
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTTTTTTT
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTTTTTTT
Antitoxin
Download Length: 125 bp
>AT50225 NZ_CP009997:c192422-192298 [Yersinia kristensenii]
AACAAATTAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTAACGTAGGCTTACTCAGCCATACTCTTTAAGAATAG
AACAAATTAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTAACGTAGGCTTACTCAGCCATACTCTTTAAGAATAG