Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3358790..3358935 | Replicon | chromosome |
Accession | NZ_CP009863 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3358797..3358899 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3358790..3358935 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KPNIH29_RS16750 | 3354322..3355755 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
KPNIH29_RS16755 | 3355871..3356110 | + | 240 | WP_002911393.1 | YebV family protein | - |
KPNIH29_RS16760 | 3356208..3356399 | + | 192 | WP_002911395.1 | YebW family protein | - |
KPNIH29_RS16765 | 3356396..3357049 | - | 654 | WP_019725444.1 | protein-serine/threonine phosphatase | - |
KPNIH29_RS16770 | 3357206..3358174 | + | 969 | WP_167876367.1 | VirK/YbjX family protein | - |
KPNIH29_RS29725 | 3358279..3358422 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3358790..3358935 | + | 146 | - | - | Antitoxin |
- | 3358797..3358899 | - | 103 | - | - | Toxin |
KPNIH29_RS16780 | 3359058..3359396 | - | 339 | WP_002911404.1 | YebY family protein | - |
KPNIH29_RS16785 | 3359413..3360282 | - | 870 | WP_038435445.1 | copper homeostasis membrane protein CopD | - |
KPNIH29_RS16790 | 3360286..3360660 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KPNIH29_RS16795 | 3360773..3361003 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KPNIH29_RS16800 | 3361082..3361741 | + | 660 | WP_021440386.1 | exodeoxyribonuclease X | - |
KPNIH29_RS16805 | 3361745..3363805 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T50057 NZ_CP009863:c3358899-3358797 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT50057 NZ_CP009863:3358790-3358935 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT