Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 909174..909267 | Replicon | chromosome |
Accession | NZ_CP009787 | ||
Organism | Yersinia rohdei strain YRA |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 909175..909267 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 909174..909267 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CH64_RS04025 | 904699..905247 | - | 549 | WP_004713101.1 | GNAT family N-acetyltransferase | - |
CH64_RS04030 | 905548..905763 | - | 216 | WP_042542351.1 | hypothetical protein | - |
CH64_RS04035 | 905966..906196 | - | 231 | Protein_802 | lysozyme | - |
CH64_RS04045 | 907076..907402 | + | 327 | WP_032815923.1 | hypothetical protein | - |
CH64_RS19310 | 907446..907982 | - | 537 | WP_004713106.1 | VRR-NUC domain-containing protein | - |
CH64_RS19515 | 908020..908304 | - | 285 | WP_071817861.1 | DUF1364 domain-containing protein | - |
CH64_RS19520 | 908306..908434 | - | 129 | WP_004713107.1 | DUF1367 family protein | - |
CH64_RS04055 | 908638..909099 | + | 462 | Protein_807 | tyrosine-type recombinase/integrase | - |
- | 909174..909267 | + | 94 | - | - | Antitoxin |
- | 909175..909267 | - | 93 | - | - | Toxin |
CH64_RS04060 | 909441..909782 | - | 342 | WP_004713110.1 | YebY family protein | - |
CH64_RS04065 | 909878..910762 | - | 885 | WP_004713111.1 | copper homeostasis membrane protein CopD | - |
CH64_RS04070 | 910764..911150 | - | 387 | WP_004713112.1 | CopC domain-containing protein YobA | - |
CH64_RS04075 | 911539..912048 | - | 510 | WP_004713113.1 | non-heme ferritin | - |
CH64_RS04080 | 912441..912671 | + | 231 | WP_004713114.1 | DNA polymerase III subunit theta | - |
CH64_RS04085 | 912725..913681 | - | 957 | WP_004713115.1 | prolyl aminopeptidase | - |
CH64_RS20385 | 913963..914115 | + | 153 | WP_004713116.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 905960..914853 | 8893 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 93 bp
>T49765 NZ_CP009787:c909267-909175 [Yersinia rohdei]
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTCTTTTT
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTCTTTTT
Antitoxin
Download Length: 94 bp
>AT49765 NZ_CP009787:909174-909267 [Yersinia rohdei]
TAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAACGTAGGCTTA
TAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAACGTAGGCTTA