Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 825189..825306 | Replicon | chromosome |
Accession | NZ_CP009781 | ||
Organism | Yersinia aldovae 670-83 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 825190..825282 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 825189..825306 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AT01_RS03850 | 820203..820535 | + | 333 | WP_025378517.1 | hypothetical protein | - |
AT01_RS03855 | 820725..821039 | + | 315 | WP_042546155.1 | hypothetical protein | - |
AT01_RS20165 | 821053..823206 | + | 2154 | WP_052489938.1 | hypothetical protein | - |
AT01_RS03865 | 823203..823715 | + | 513 | WP_042546156.1 | siphovirus Gp157 family protein | - |
AT01_RS03870 | 823788..824054 | + | 267 | WP_042546157.1 | excisionase | - |
AT01_RS03875 | 824029..825111 | + | 1083 | WP_042546158.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 825189..825306 | + | 118 | - | - | Antitoxin |
- | 825190..825282 | - | 93 | - | - | Toxin |
AT01_RS03880 | 825457..825798 | - | 342 | WP_042546159.1 | YebY family protein | - |
AT01_RS03885 | 825895..826779 | - | 885 | WP_042546160.1 | copper homeostasis membrane protein CopD | - |
AT01_RS03890 | 826782..827186 | - | 405 | WP_042546161.1 | CopC domain-containing protein YobA | - |
AT01_RS03895 | 827571..828080 | - | 510 | WP_042546162.1 | non-heme ferritin | - |
AT01_RS03900 | 828468..828698 | + | 231 | WP_004701745.1 | DNA polymerase III subunit theta | - |
AT01_RS03905 | 828781..829731 | - | 951 | WP_042546163.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 764196..830912 | 66716 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 93 bp
>T49721 NZ_CP009781:c825282-825190 [Yersinia aldovae 670-83]
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTCTTTTT
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTCTTTTT
Antitoxin
Download Length: 118 bp
>AT49721 NZ_CP009781:825189-825306 [Yersinia aldovae 670-83]
TAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAACGTAGGCTTATTCAGCCTTACTCTTTAAGAGTAG
TAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAACGTAGGCTTATTCAGCCTTACTCTTTAAGAGTAG