Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3349256..3349401 | Replicon | chromosome |
Accession | NZ_CP009775 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3349263..3349365 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3349256..3349401 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KPNIH32_RS16960 | 3344788..3346221 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
KPNIH32_RS16965 | 3346337..3346576 | + | 240 | WP_002911393.1 | YebV family protein | - |
KPNIH32_RS16970 | 3346674..3346865 | + | 192 | WP_002911395.1 | YebW family protein | - |
KPNIH32_RS16975 | 3346862..3347515 | - | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
KPNIH32_RS16980 | 3347672..3348640 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KPNIH32_RS32290 | 3348745..3348888 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3349256..3349401 | + | 146 | - | - | Antitoxin |
- | 3349263..3349365 | - | 103 | - | - | Toxin |
KPNIH32_RS16990 | 3349524..3349862 | - | 339 | WP_002911404.1 | YebY family protein | - |
KPNIH32_RS16995 | 3349879..3350748 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
KPNIH32_RS17000 | 3350752..3351126 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KPNIH32_RS17005 | 3351239..3351469 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KPNIH32_RS17010 | 3351548..3352207 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KPNIH32_RS17015 | 3352211..3354271 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T49693 NZ_CP009775:c3349365-3349263 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT49693 NZ_CP009775:3349256-3349401 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT