Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3398920..3399065 | Replicon | chromosome |
Accession | NZ_CP009771 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3398927..3399029 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3398920..3399065 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KPNIH33_RS17200 | 3394452..3395885 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
KPNIH33_RS17205 | 3396001..3396240 | + | 240 | WP_002911393.1 | YebV family protein | - |
KPNIH33_RS17210 | 3396338..3396529 | + | 192 | WP_002911395.1 | YebW family protein | - |
KPNIH33_RS17215 | 3396526..3397179 | - | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
KPNIH33_RS17220 | 3397336..3398304 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KPNIH33_RS30965 | 3398409..3398552 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3398920..3399065 | + | 146 | - | - | Antitoxin |
- | 3398927..3399029 | - | 103 | - | - | Toxin |
KPNIH33_RS17230 | 3399188..3399526 | - | 339 | WP_002911404.1 | YebY family protein | - |
KPNIH33_RS17235 | 3399543..3400412 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
KPNIH33_RS17240 | 3400416..3400790 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KPNIH33_RS17245 | 3400903..3401133 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KPNIH33_RS17250 | 3401212..3401871 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KPNIH33_RS17255 | 3401875..3403935 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T49673 NZ_CP009771:c3399029-3398927 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT49673 NZ_CP009771:3398920-3399065 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT