Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2663151..2663275 | Replicon | chromosome |
Accession | NZ_CP009456 | ||
Organism | Yersinia enterocolitica strain FORC_002 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2663159..2663253 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2663151..2663275 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LI89_RS12060 | 2658302..2659966 | - | 1665 | WP_046694910.1 | glycoside hydrolase family 104 protein | - |
LI89_RS12065 | 2660084..2660380 | - | 297 | WP_102895904.1 | hypothetical protein | - |
LI89_RS12070 | 2660370..2660948 | - | 579 | WP_046694908.1 | hypothetical protein | - |
LI89_RS12075 | 2661211..2661600 | - | 390 | WP_019079702.1 | hypothetical protein | - |
LI89_RS12080 | 2661603..2662007 | - | 405 | WP_019079703.1 | hypothetical protein | - |
LI89_RS12085 | 2662014..2662484 | - | 471 | Protein_2342 | hypothetical protein | - |
LI89_RS12090 | 2662496..2663080 | + | 585 | WP_020424089.1 | tyrosine-type recombinase/integrase | - |
- | 2663151..2663275 | + | 125 | - | - | Antitoxin |
- | 2663159..2663253 | - | 95 | - | - | Toxin |
LI89_RS12095 | 2663427..2663768 | - | 342 | WP_005170437.1 | YebY family protein | - |
LI89_RS12100 | 2663865..2664749 | - | 885 | WP_046694907.1 | copper homeostasis membrane protein CopD | - |
LI89_RS12105 | 2664751..2665137 | - | 387 | WP_005170441.1 | CopC domain-containing protein YobA | - |
LI89_RS12110 | 2665528..2666037 | - | 510 | WP_005170444.1 | non-heme ferritin | - |
LI89_RS12115 | 2666421..2666654 | + | 234 | WP_046694906.1 | DNA polymerase III subunit theta | - |
LI89_RS12120 | 2666703..2667659 | - | 957 | WP_019079708.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2628701..2668832 | 40131 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 95 bp
>T49056 NZ_CP009456:c2663253-2663159 [Yersinia enterocolitica]
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTCTTTTT
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTCTTTTT
Antitoxin
Download Length: 125 bp
>AT49056 NZ_CP009456:2663151-2663275 [Yersinia enterocolitica]
AACAGCTTAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG
AACAGCTTAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG