Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1590632..1590756 | Replicon | chromosome |
Accession | NZ_CP009364 | ||
Organism | Yersinia frederiksenii Y225 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1590640..1590732 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1590632..1590756 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AW19_RS07635 | 1586345..1587217 | - | 873 | WP_038632453.1 | 23S rRNA pseudouridine(2604) synthase RluF | - |
AW19_RS07640 | 1587486..1588649 | + | 1164 | WP_071841717.1 | class C beta-lactamase | - |
AW19_RS21595 | 1588932..1589102 | - | 171 | WP_187142909.1 | hypothetical protein | - |
AW19_RS07645 | 1589229..1589468 | + | 240 | WP_012105237.1 | type II toxin-antitoxin system RelB/DinJ family antitoxin | - |
AW19_RS07650 | 1589458..1589742 | + | 285 | WP_038632447.1 | type II toxin-antitoxin system RelE/ParE family toxin | - |
AW19_RS07655 | 1589753..1590380 | - | 628 | Protein_1422 | terminase small subunit | - |
- | 1590632..1590756 | + | 125 | - | - | Antitoxin |
- | 1590640..1590732 | - | 93 | - | - | Toxin |
AW19_RS07660 | 1590906..1591247 | - | 342 | WP_038632445.1 | YebY family protein | - |
AW19_RS07665 | 1591344..1592228 | - | 885 | WP_038632443.1 | copper homeostasis membrane protein CopD | - |
AW19_RS07670 | 1592230..1592616 | - | 387 | WP_038632441.1 | CopC domain-containing protein YobA | - |
AW19_RS07675 | 1593006..1593515 | - | 510 | WP_038632439.1 | non-heme ferritin | - |
AW19_RS07680 | 1593909..1594142 | + | 234 | WP_038632437.1 | DNA polymerase III subunit theta | - |
AW19_RS07685 | 1594192..1595148 | - | 957 | WP_038632429.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1587468..1596326 | 8858 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 93 bp
>T48811 NZ_CP009364:c1590732-1590640 [Yersinia frederiksenii Y225]
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTTTTTTT
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTTTTTTT
Antitoxin
Download Length: 125 bp
>AT48811 NZ_CP009364:1590632-1590756 [Yersinia frederiksenii Y225]
AACAAATTAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTAACGTAGGCTTACTCAGCCATACTCTTTAAGAATAG
AACAAATTAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTAACGTAGGCTTACTCAGCCATACTCTTTAAGAATAG