Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3367589..3367734 | Replicon | chromosome |
Accession | NZ_CP008831 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae KPR0928 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3367596..3367698 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3367589..3367734 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KPR0928_RS17065 | 3363121..3364554 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
KPR0928_RS17070 | 3364670..3364909 | + | 240 | WP_002911393.1 | YebV family protein | - |
KPR0928_RS17075 | 3365007..3365198 | + | 192 | WP_002911395.1 | YebW family protein | - |
KPR0928_RS17080 | 3365195..3365848 | - | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
KPR0928_RS17085 | 3366005..3366973 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KPR0928_RS29385 | 3367078..3367221 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3367589..3367734 | + | 146 | - | - | Antitoxin |
- | 3367596..3367698 | - | 103 | - | - | Toxin |
KPR0928_RS17095 | 3367857..3368195 | - | 339 | WP_002911404.1 | YebY family protein | - |
KPR0928_RS17100 | 3368212..3369081 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
KPR0928_RS17105 | 3369085..3369459 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KPR0928_RS17110 | 3369572..3369802 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KPR0928_RS17115 | 3369881..3370540 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KPR0928_RS17120 | 3370544..3372604 | - | 2061 | WP_032422099.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T47671 NZ_CP008831:c3367698-3367596 [Klebsiella pneumoniae subsp. pneumoniae KPR0928]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT47671 NZ_CP008831:3367589-3367734 [Klebsiella pneumoniae subsp. pneumoniae KPR0928]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT