Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1993974..1994119 | Replicon | chromosome |
Accession | NZ_CP006923 | ||
Organism | Klebsiella pneumoniae 30660/NJST258_1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1994010..1994112 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1993974..1994119 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KPNJ1_RS09965 | 1989104..1991164 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KPNJ1_RS09970 | 1991168..1991827 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KPNJ1_RS09975 | 1991906..1992136 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KPNJ1_RS09980 | 1992249..1992623 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KPNJ1_RS09985 | 1992627..1993496 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
KPNJ1_RS09990 | 1993513..1993851 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1993974..1994119 | - | 146 | - | - | Antitoxin |
- | 1994010..1994112 | + | 103 | - | - | Toxin |
KPNJ1_RS30380 | 1994487..1994630 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KPNJ1_RS10000 | 1994735..1995703 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KPNJ1_RS10005 | 1995860..1996513 | + | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
KPNJ1_RS10010 | 1996510..1996701 | - | 192 | WP_002911395.1 | YebW family protein | - |
KPNJ1_RS10015 | 1996799..1997038 | - | 240 | WP_002911393.1 | YebV family protein | - |
KPNJ1_RS10020 | 1997154..1998587 | - | 1434 | WP_025403962.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T45753 NZ_CP006923:1994010-1994112 [Klebsiella pneumoniae 30660/NJST258_1]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT45753 NZ_CP006923:c1994119-1993974 [Klebsiella pneumoniae 30660/NJST258_1]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT