Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1472234..1472379 | Replicon | chromosome |
Accession | NZ_CP006798 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae PittNDM01 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1472241..1472343 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1472234..1472379 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
Q770_RS07285 | 1467765..1469198 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Q770_RS07290 | 1469314..1469553 | + | 240 | WP_002911393.1 | YebV family protein | - |
Q770_RS07295 | 1469651..1469842 | + | 192 | WP_002911395.1 | YebW family protein | - |
Q770_RS07300 | 1469839..1470492 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
Q770_RS07305 | 1470649..1471617 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
Q770_RS31260 | 1471722..1471865 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 1472234..1472379 | + | 146 | - | - | Antitoxin |
- | 1472241..1472343 | - | 103 | - | - | Toxin |
Q770_RS07315 | 1472502..1472840 | - | 339 | WP_002911404.1 | YebY family protein | - |
Q770_RS07320 | 1472857..1473726 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
Q770_RS07325 | 1473730..1474104 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
Q770_RS07330 | 1474217..1474447 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
Q770_RS07335 | 1474526..1475185 | + | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
Q770_RS07340 | 1475189..1477249 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T45604 NZ_CP006798:c1472343-1472241 [Klebsiella pneumoniae subsp. pneumoniae PittNDM01]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT45604 NZ_CP006798:1472234-1472379 [Klebsiella pneumoniae subsp. pneumoniae PittNDM01]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT