Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1945927..1946072 | Replicon | chromosome |
Accession | NZ_CP006738 | ||
Organism | Klebsiella pneumoniae HK787 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1945963..1946065 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1945927..1946072 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
P244_RS09465 | 1941057..1943117 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
P244_RS09470 | 1943121..1943780 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
P244_RS09475 | 1943859..1944089 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
P244_RS09480 | 1944202..1944576 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
P244_RS09485 | 1944580..1945449 | + | 870 | WP_004189267.1 | copper homeostasis membrane protein CopD | - |
P244_RS09490 | 1945466..1945804 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1945927..1946072 | - | 146 | - | - | Antitoxin |
- | 1945963..1946065 | + | 103 | - | - | Toxin |
P244_RS27950 | 1946439..1946582 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
P244_RS09500 | 1946687..1947655 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
P244_RS09505 | 1947812..1948465 | + | 654 | WP_004189273.1 | protein-serine/threonine phosphatase | - |
P244_RS09510 | 1948462..1948653 | - | 192 | WP_002911395.1 | YebW family protein | - |
P244_RS09515 | 1948751..1948990 | - | 240 | WP_002911393.1 | YebV family protein | - |
P244_RS09520 | 1949106..1950539 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T45479 NZ_CP006738:1945963-1946065 [Klebsiella pneumoniae HK787]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAGGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAGGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT45479 NZ_CP006738:c1946072-1945927 [Klebsiella pneumoniae HK787]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCCTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCCTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT