Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2104158..2104303 | Replicon | chromosome |
Accession | NZ_CP006722 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae 1158 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2104194..2104296 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2104158..2104303 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
P243_RS09955 | 2099288..2101348 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
P243_RS09960 | 2101352..2102011 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
P243_RS09965 | 2102090..2102320 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
P243_RS09970 | 2102433..2102807 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
P243_RS09975 | 2102811..2103680 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
P243_RS09980 | 2103697..2104035 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2104158..2104303 | - | 146 | - | - | Antitoxin |
- | 2104194..2104296 | + | 103 | - | - | Toxin |
P243_RS28360 | 2104671..2104814 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
P243_RS09990 | 2104919..2105887 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
P243_RS09995 | 2106044..2106697 | + | 654 | WP_004891053.1 | protein-serine/threonine phosphatase | - |
P243_RS10000 | 2106694..2106885 | - | 192 | WP_002911395.1 | YebW family protein | - |
P243_RS10005 | 2106983..2107222 | - | 240 | WP_002911393.1 | YebV family protein | - |
P243_RS10010 | 2107338..2108771 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T45458 NZ_CP006722:2104194-2104296 [Klebsiella pneumoniae subsp. pneumoniae 1158]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT45458 NZ_CP006722:c2104303-2104158 [Klebsiella pneumoniae subsp. pneumoniae 1158]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT