Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3415864..3416009 | Replicon | chromosome |
Accession | NZ_CP006659 | ||
Organism | Klebsiella pneumoniae strain ATCC BAA-2146 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3415871..3415973 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3415864..3416009 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
kpn2146_RS17265 | 3411397..3412830 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
kpn2146_RS17270 | 3412946..3413185 | + | 240 | WP_002911393.1 | YebV family protein | - |
kpn2146_RS17275 | 3413283..3413474 | + | 192 | WP_002911395.1 | YebW family protein | - |
kpn2146_RS17280 | 3413471..3414124 | - | 654 | WP_004189273.1 | protein-serine/threonine phosphatase | - |
kpn2146_RS17285 | 3414281..3415249 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
kpn2146_RS31970 | 3415354..3415497 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3415864..3416009 | + | 146 | - | - | Antitoxin |
- | 3415871..3415973 | - | 103 | - | - | Toxin |
kpn2146_RS17295 | 3416132..3416470 | - | 339 | WP_004189269.1 | YebY family protein | - |
kpn2146_RS17300 | 3416487..3417356 | - | 870 | WP_004189267.1 | copper homeostasis membrane protein CopD | - |
kpn2146_RS17305 | 3417360..3417734 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
kpn2146_RS17310 | 3417847..3418077 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
kpn2146_RS17315 | 3418156..3418815 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
kpn2146_RS17320 | 3418819..3420879 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T45378 NZ_CP006659:c3415973-3415871 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT45378 NZ_CP006659:3415864-3416009 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT