Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1992129..1992269 | Replicon | chromosome |
Accession | NZ_CP003424 | ||
Organism | Serratia sp. SCBI |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1992173..1992269 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1992129..1992269 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SERRSCBI_RS09255 | 1987353..1987778 | + | 426 | WP_033652008.1 | RNA polymerase-binding protein DksA | - |
SERRSCBI_RS09260 | 1987956..1988909 | + | 954 | WP_033644252.1 | prolyl aminopeptidase | - |
SERRSCBI_RS09265 | 1988941..1989171 | - | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
SERRSCBI_RS09270 | 1989512..1990030 | + | 519 | WP_033642716.1 | non-heme ferritin | - |
SERRSCBI_RS09275 | 1990353..1990736 | + | 384 | WP_004940886.1 | CopC domain-containing protein YobA | - |
SERRSCBI_RS09280 | 1990739..1991620 | + | 882 | WP_042784225.1 | copper homeostasis membrane protein CopD | - |
SERRSCBI_RS09285 | 1991690..1992031 | + | 342 | WP_016928154.1 | YebY family protein | - |
- | 1992129..1992269 | - | 141 | - | - | Antitoxin |
- | 1992173..1992269 | + | 97 | - | - | Toxin |
SERRSCBI_RS24055 | 1992348..1992474 | - | 127 | Protein_1835 | integrase | - |
SERRSCBI_RS09290 | 1992872..1993774 | + | 903 | WP_049866671.1 | hypothetical protein | - |
SERRSCBI_RS09300 | 1994382..1995035 | - | 654 | WP_042784228.1 | hypothetical protein | - |
SERRSCBI_RS09305 | 1995318..1995721 | + | 404 | Protein_1838 | hypothetical protein | - |
SERRSCBI_RS09310 | 1995718..1995936 | - | 219 | WP_033640661.1 | hypothetical protein | - |
SERRSCBI_RS09315 | 1996011..1996355 | - | 345 | WP_033642719.1 | hypothetical protein | - |
SERRSCBI_RS09320 | 1996604..1996954 | + | 351 | WP_004940949.1 | DUF4377 domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T44846 NZ_CP003424:1992173-1992269 [Serratia sp. SCBI]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT44846 NZ_CP003424:c1992269-1992129 [Serratia sp. SCBI]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG