Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1997016..1997159 | Replicon | chromosome |
Accession | NZ_AP026948 | ||
Organism | Salmonella enterica strain SE20-72C-2 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1997054..1997157 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1997016..1997159 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OO990_RS09670 (SE2072C2_18710) | 1993439..1994137 | - | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
OO990_RS09675 (SE2072C2_18720) | 1994161..1994817 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
OO990_RS09680 (SE2072C2_18730) | 1994925..1995155 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
OO990_RS09685 (SE2072C2_18740) | 1995293..1995667 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
OO990_RS09690 (SE2072C2_18750) | 1995668..1996543 | + | 876 | WP_000979695.1 | copper homeostasis membrane protein CopD | - |
OO990_RS09695 (SE2072C2_18760) | 1996560..1996913 | + | 354 | WP_000722363.1 | YebY family protein | - |
- | 1997016..1997159 | - | 144 | - | - | Antitoxin |
- | 1997054..1997157 | + | 104 | - | - | Toxin |
OO990_RS09700 (SE2072C2_18770) | 1997288..1998367 | - | 1080 | WP_000087641.1 | phage integrase Arm DNA-binding domain-containing protein | - |
OO990_RS09705 (SE2072C2_18780) | 1998400..1999548 | - | 1149 | Protein_1895 | PD-(D/E)XK nuclease-like domain-containing protein | - |
OO990_RS09710 (SE2072C2_18790) | 1999540..1999788 | + | 249 | Protein_1896 | glycoside hydrolase family 19 protein | - |
OO990_RS09715 | 1999785..2000317 | + | 533 | Protein_1897 | DUF2514 domain-containing protein | - |
OO990_RS09720 (SE2072C2_18810) | 2000574..2000741 | - | 168 | WP_000789530.1 | lytic enzyme | - |
OO990_RS09725 (SE2072C2_18820) | 2001044..2001535 | + | 492 | WP_000348547.1 | DUF1441 family protein | - |
OO990_RS09730 | 2001522..2002089 | + | 568 | Protein_1900 | phage terminase large subunit family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 1975143..2030209 | 55066 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T42905 NZ_AP026948:1997054-1997157 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT42905 NZ_AP026948:c1997159-1997016 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG