Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1871505..1871650 | Replicon | chromosome |
Accession | NZ_AP026525 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain TUM9839 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1871541..1871643 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1871505..1871650 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OO859_RS09040 (TUM9839_17540) | 1866635..1868695 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
OO859_RS09045 (TUM9839_17550) | 1868699..1869358 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
OO859_RS09050 (TUM9839_17560) | 1869437..1869667 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
OO859_RS09055 (TUM9839_17570) | 1869780..1870154 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
OO859_RS09060 (TUM9839_17580) | 1870158..1871027 | + | 870 | WP_023282759.1 | copper homeostasis membrane protein CopD | - |
OO859_RS09065 (TUM9839_17590) | 1871044..1871382 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1871505..1871650 | - | 146 | - | - | Antitoxin |
- | 1871541..1871643 | + | 103 | - | - | Toxin |
OO859_RS09070 | 1872019..1872162 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
OO859_RS09075 (TUM9839_17600) | 1872267..1873235 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
OO859_RS09080 (TUM9839_17610) | 1873392..1874045 | + | 654 | WP_020802220.1 | protein-serine/threonine phosphatase | - |
OO859_RS09085 (TUM9839_17620) | 1874042..1874233 | - | 192 | WP_002911395.1 | YebW family protein | - |
OO859_RS09090 (TUM9839_17630) | 1874331..1874570 | - | 240 | WP_002911393.1 | YebV family protein | - |
OO859_RS09095 (TUM9839_17640) | 1874686..1876119 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T42522 NZ_AP026525:1871541-1871643 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT42522 NZ_AP026525:c1871650-1871505 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT