Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1962140..1962287 | Replicon | chromosome |
Accession | NZ_AP026407 | ||
Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM644 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1962181..1962283 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1962140..1962287 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
P4I75_RS09665 | 1957275..1959335 | + | 2061 | WP_186976664.1 | oligopeptidase B | - |
P4I75_RS09670 | 1959339..1959998 | - | 660 | WP_023290237.1 | exodeoxyribonuclease X | - |
P4I75_RS09675 | 1960077..1960307 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
P4I75_RS09680 | 1960420..1960794 | + | 375 | WP_032453372.1 | CopC domain-containing protein YobA | - |
P4I75_RS09685 | 1960798..1961667 | + | 870 | WP_101976597.1 | copper homeostasis membrane protein CopD | - |
P4I75_RS09690 | 1961684..1962022 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1962140..1962287 | - | 148 | - | - | Antitoxin |
- | 1962181..1962283 | + | 103 | - | - | Toxin |
P4I75_RS09695 | 1962662..1962805 | - | 144 | WP_032425946.1 | Ecr family regulatory small membrane protein | - |
P4I75_RS09700 | 1962909..1963877 | - | 969 | WP_072413392.1 | VirK/YbjX family protein | - |
P4I75_RS09705 | 1964034..1964687 | + | 654 | WP_261902277.1 | protein-serine/threonine phosphatase | - |
P4I75_RS09710 | 1964684..1964875 | - | 192 | WP_002911395.1 | YebW family protein | - |
P4I75_RS09715 | 1964973..1965212 | - | 240 | WP_002911393.1 | YebV family protein | - |
P4I75_RS09720 | 1965328..1966758 | - | 1431 | WP_261902278.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T42483 NZ_AP026407:1962181-1962283 [Klebsiella quasipneumoniae subsp. quasipneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 148 bp
>AT42483 NZ_AP026407:c1962287-1962140 [Klebsiella quasipneumoniae subsp. quasipneumoniae]
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG