Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1910315..1910459 | Replicon | chromosome |
Accession | NZ_AP024592 | ||
Organism | Klebsiella variicola strain JCM 12419 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1910351..1910453 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1910315..1910459 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KI238_RS09180 (KLVA_17670) | 1905445..1907505 | + | 2061 | WP_012541258.1 | oligopeptidase B | - |
KI238_RS09185 (KLVA_17680) | 1907509..1908168 | - | 660 | WP_012541259.1 | exodeoxyribonuclease X | - |
KI238_RS09190 (KLVA_17690) | 1908247..1908477 | - | 231 | WP_012541260.1 | DNA polymerase III subunit theta | - |
KI238_RS09195 (KLVA_17700) | 1908591..1908965 | + | 375 | WP_012541261.1 | CopC domain-containing protein YobA | - |
KI238_RS09200 (KLVA_17710) | 1908969..1909838 | + | 870 | WP_012541262.1 | copper homeostasis membrane protein CopD | - |
KI238_RS09205 (KLVA_17720) | 1909855..1910193 | + | 339 | WP_008804271.1 | YebY family protein | - |
- | 1910315..1910459 | - | 145 | - | - | Antitoxin |
- | 1910351..1910453 | + | 103 | - | - | Toxin |
KI238_RS09210 | 1910838..1910981 | - | 144 | WP_048268691.1 | Ecr family regulatory small membrane protein | - |
KI238_RS09215 (KLVA_17740) | 1911085..1912053 | - | 969 | WP_162493241.1 | VirK/YbjX family protein | - |
KI238_RS09220 (KLVA_17750) | 1912210..1912863 | + | 654 | WP_008804273.1 | protein-serine/threonine phosphatase | - |
KI238_RS09225 (KLVA_17760) | 1912860..1913051 | - | 192 | WP_002911395.1 | YebW family protein | - |
KI238_RS09230 (KLVA_17770) | 1913149..1913388 | - | 240 | WP_002911393.1 | YebV family protein | - |
KI238_RS09235 (KLVA_17780) | 1913504..1914937 | - | 1434 | WP_046881617.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T38884 NZ_AP024592:1910351-1910453 [Klebsiella variicola]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 145 bp
>AT38884 NZ_AP024592:c1910459-1910315 [Klebsiella variicola]
ACCGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ACCGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT