Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2696290..2696439 | Replicon | chromosome |
| Accession | NZ_AP024585 | ||
| Organism | Citrobacter amalonaticus strain JCM 1661 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2696296..2696399 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2696290..2696439 (+) |
Genomic Context
Location: 2693399..2694838 (1440 bp)
Type: Others
Protein ID: WP_061070014.1
Type: Others
Protein ID: WP_061070014.1
Location: 2694953..2695189 (237 bp)
Type: Others
Protein ID: WP_161215572.1
Type: Others
Protein ID: WP_161215572.1
Location: 2695291..2695482 (192 bp)
Type: Others
Protein ID: WP_043000391.1
Type: Others
Protein ID: WP_043000391.1
Location: 2696290..2696439 (150 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2698297..2698527 (231 bp)
Type: Others
Protein ID: WP_042318454.1
Type: Others
Protein ID: WP_042318454.1
Location: 2698636..2699298 (663 bp)
Type: Others
Protein ID: WP_061070012.1
Type: Others
Protein ID: WP_061070012.1
Location: 2699322..2699984 (663 bp)
Type: Others
Protein ID: WP_043000375.1
Type: Others
Protein ID: WP_043000375.1
Location: 2695483..2696145 (663 bp)
Type: Others
Protein ID: WP_043000390.1
Type: Others
Protein ID: WP_043000390.1
Location: 2696296..2696399 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 2696555..2696893 (339 bp)
Type: Others
Protein ID: WP_043000379.1
Type: Others
Protein ID: WP_043000379.1
Location: 2696910..2697782 (873 bp)
Type: Others
Protein ID: WP_061070013.1
Type: Others
Protein ID: WP_061070013.1
Location: 2697785..2698159 (375 bp)
Type: Others
Protein ID: WP_044326804.1
Type: Others
Protein ID: WP_044326804.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KI228_RS12655 (CIAM_24760) | 2693399..2694838 | + | 1440 | WP_061070014.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
| KI228_RS12660 (CIAM_24770) | 2694953..2695189 | + | 237 | WP_161215572.1 | YebV family protein | - |
| KI228_RS12665 (CIAM_24780) | 2695291..2695482 | + | 192 | WP_043000391.1 | YebW family protein | - |
| KI228_RS12670 (CIAM_24790) | 2695483..2696145 | - | 663 | WP_043000390.1 | protein-serine/threonine phosphatase | - |
| - | 2696290..2696439 | + | 150 | - | - | Antitoxin |
| - | 2696296..2696399 | - | 104 | - | - | Toxin |
| KI228_RS12675 (CIAM_24800) | 2696555..2696893 | - | 339 | WP_043000379.1 | YebY family protein | - |
| KI228_RS12680 (CIAM_24810) | 2696910..2697782 | - | 873 | WP_061070013.1 | copper homeostasis membrane protein CopD | - |
| KI228_RS12685 (CIAM_24820) | 2697785..2698159 | - | 375 | WP_044326804.1 | CopC domain-containing protein YobA | - |
| KI228_RS12690 (CIAM_24830) | 2698297..2698527 | + | 231 | WP_042318454.1 | DNA polymerase III subunit theta | - |
| KI228_RS12695 (CIAM_24840) | 2698636..2699298 | + | 663 | WP_061070012.1 | carbon-nitrogen hydrolase family protein | - |
| KI228_RS12700 (CIAM_24850) | 2699322..2699984 | + | 663 | WP_043000375.1 | exodeoxyribonuclease X | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| No matching records found | |||||||
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T38866 NZ_AP024585:c2696399-2696296 [Citrobacter amalonaticus]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 150 bp
>AT38866 NZ_AP024585:2696290-2696439 [Citrobacter amalonaticus]
ACAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTCTGCG
ACAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTCTGCG
