Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2120010..2120153 | Replicon | chromosome |
Accession | NZ_AP024347 | ||
Organism | Salmonella enterica strain SEOhiM1593 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2120048..2120151 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2120010..2120153 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QMN54_RS10245 (SAML1593_19720) | 2116434..2117132 | - | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
QMN54_RS10250 (SAML1593_19730) | 2117156..2117812 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
QMN54_RS10255 (SAML1593_19740) | 2117920..2118150 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
QMN54_RS10260 (SAML1593_19750) | 2118288..2118662 | + | 375 | WP_023258790.1 | CopC domain-containing protein YobA | - |
QMN54_RS10265 (SAML1593_19760) | 2118663..2119538 | + | 876 | WP_017441953.1 | copper homeostasis membrane protein CopD | - |
QMN54_RS10270 (SAML1593_19770) | 2119555..2119908 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 2120010..2120153 | - | 144 | - | - | Antitoxin |
- | 2120048..2120151 | + | 104 | - | - | Toxin |
QMN54_RS10275 (SAML1593_19780) | 2120282..2120932 | - | 651 | Protein_2009 | tyrosine-type recombinase/integrase | - |
QMN54_RS10280 (SAML1593_19790) | 2120943..2121248 | + | 306 | WP_223195158.1 | hypothetical protein | - |
QMN54_RS10285 | 2121202..2121408 | + | 207 | Protein_2011 | phage tail protein | - |
QMN54_RS10290 | 2121580..2121735 | + | 156 | Protein_2012 | phage tail protein | - |
QMN54_RS10295 | 2121841..2122173 | + | 333 | WP_031607880.1 | DUF1353 domain-containing protein | - |
QMN54_RS10300 | 2122222..2122331 | + | 110 | Protein_2014 | tail fiber assembly protein | - |
QMN54_RS10305 | 2122851..2122946 | - | 96 | WP_024133706.1 | hypothetical protein | - |
QMN54_RS10310 (SAML1593_19820) | 2123044..2123814 | - | 771 | WP_023258343.1 | transporter substrate-binding domain-containing protein | - |
QMN54_RS10315 | 2124305..2124433 | + | 129 | Protein_2017 | helix-turn-helix domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T38411 NZ_AP024347:2120048-2120151 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT38411 NZ_AP024347:c2120153-2120010 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG